Top » Catalog » R1b » A1707

$19.00

A1707
[A1707]

A1707
hg38 Position: ChrY:8722210..8722210
Ancestral: G
Derived: C
Reference: Terry Barton (2015)
ISOGG Haplogroup: R1b1a2a1a2b1b (not listed)
Comments: Approximately L196
Forward Primer: A1707_F AGGTGCCTGGATTTCAGAAC
Reverse Primer: A1707_R ACTGCAAGGCCCAGGAG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies