Top » Catalog » R1b » A697

$19.00

A697
[A697]

A697
hg38 Position: ChrY:10042603..10042603
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A697_F CATACATAGCATTAACTGGCACG
Reverse Primer: A697_R TAGAAAGCACTTAAGTGCTCAATTCTAC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies