Top » Catalog » R1b » A921

$18.00

A921
[A921]

A921
hg38 Position: ChrY:8571805..8571805
Ancestral: G
Derived: A
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1a (not listed)
Comments: Downstream S781
Forward Primer: A921_F CTTCCTGCAGAAGCACACAG
Reverse Primer: A921_R ACTGTCTCTCCATGGGTTGG
Reviews

Customers who bought this product also purchased
A922
A922
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2233
$18.00
Haplogroup Info
Other products
Currencies