Top » Catalog » R1b » Z29644

$18.00

Z29644
[Z29644]

Z29644
hg38 Position: ChrY:13176457..13176457
Ancestral: T
Derived: C
Reference: AP (2015)
ISOGG Haplogroup: R1b1a2a1a2 (not listed)
Comments: Below ZZ37
Forward Primer: Z29644_F GGGTTTCACCCTGTTGGC
Reverse Primer: Z29644_R ACTGAAACAGTGAAAAAAGATTTGC
Reviews

Customers who bought this product also purchased
Z30597
Z30597
Z39300
Z39300
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z17615
1 x Z21082
$36.00
Haplogroup Info
Other products
Currencies