Top » Catalog » R1b » A907

$18.00

A907
[A907]

A907
hg38 Position: ChrY:13346190..13346190
Ancestral: C
Derived: G
Reference: Maynard (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream or equivalent L701
Forward Primer: A907_F GTTTGAAGTCCAAACTGGCA
Reverse Primer: A907_R CTGATCAAAGATTAGTAGCCCTTTAG
Reviews

Customers who bought this product also purchased
A9010
A9010
A909
A909
A908
A908
A890
A890
L701
L701
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A763
1 x A1094
1 x A2261
1 x A752
1 x A151
1 x A2262
1 x A541
1 x A386
1 x A161
1 x A455
$198.00
Haplogroup Info
Other products
Currencies