Top » Catalog » R1b » A109

$18.00

A109
[A109]

A109
hg38 Position: ChrY:19739096..19739096
Ancestral: T
Derived: C
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i6~
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A109_F CTGCTCTGTCTTGCCTTTCC
Reverse Primer: A109_R TCTCCCTCTACAGCCTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
1 x A244
1 x A1719
1 x A2185
1 x A240
1 x A896
1 x A848
1 x A344
1 x A16
1 x A1067
1 x A1120
1 x A938
1 x A1341
1 x A568
1 x A2200
$270.00
Haplogroup Info
Other products
Currencies