Top » Catalog » R1b » A304

$18.00

A304
[A304]

A304
hg38 Position: ChrY:7356558..7356558
Ancestral: G
Derived: C
Reference: Connie McKenzie (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a1a1b1 (no listed)
Comments: .
Forward Primer: A304_F GTATGTTATATTTAAAATGAGCCAATTAATG
Reverse Primer: A304_R CAAAAGCATTCTTATATTTAACAAAATGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies