Top » Catalog » R1b » A1190

$18.00

A1190
[A1190]

A1190
hg38 Position: ChrY:13100046..13100046
Ancestral: A
Derived: C
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream CTS3937
Forward Primer: A1190_F ATGAGAGGCAGAGGTGTGTG
Reverse Primer: A1190_R TGAGCAAAGAGGAAAAGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies