Top » Catalog » R1b » A337

$18.00

A337
[A337]

A337
hg38 Position: ChrY:7475462..7475462
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A337_F TTTGCTGTTTTAGTCATGAAGTCTG
Reverse Primer: A337_R CTACTTTAAAGTTCATATGGAACCCG
Reviews

Customers who bought this product also purchased
A292
A292
DYS481
DYS481
A344
A344
A211
A211
A349
A349
A217
A217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies