Top » Catalog » R1b » A337

$18.00

A337
[A337]

A337
hg38 Position: ChrY:7475462..7475462
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A337_F TTTGCTGTTTTAGTCATGAAGTCTG
Reverse Primer: A337_R CTACTTTAAAGTTCATATGGAACCCG
Reviews

Customers who bought this product also purchased
A206
A206
A341
A341
A214
A214
A351
A351
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A567
1 x A1327
1 x A2163
1 x A127
1 x A1787
1 x A1285
1 x A802
1 x A70
1 x A2145
1 x A990
1 x A97
1 x A552
1 x A425
1 x A787
1 x A68
1 x A2120
1 x A614
1 x A117
1 x A2238
1 x A850
1 x A1148
$378.00
Haplogroup Info
Other products
Currencies