Top » Catalog » R1b » A338

$18.00

A338
[A338]

A338
hg38 Position: ChrY:9624348..9624348
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A338_F CCTGTATACACCTAGGTGTGAGACG
Reverse Primer: A338_R AGAGTCTGTTGTGGGCCGT
Reviews

Customers who bought this product also purchased
A218
A218
A354
A354
A340
A340
A208
A208
A347
A347
A216
A216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies