Top » Catalog » R1b » A338

$18.00

A338
[A338]

A338
hg38 Position: ChrY:9624348..9624348
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A338_F CCTGTATACACCTAGGTGTGAGACG
Reverse Primer: A338_R AGAGTCTGTTGTGGGCCGT
Reviews

Customers who bought this product also purchased
DYS481
DYS481
A344
A344
A211
A211
A349
A349
A217
A217
A355
A355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A597
$18.00
Haplogroup Info
Other products
Currencies