Top » Catalog » R1b » A340

$18.00

A340
[A340]

A340
hg38 Position: ChrY:12257083..12257083
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A340_F ACATATTCACATTTATATATTTATGAATATATATGC
Reverse Primer: A340_R GAAGCATGATGATTGTATATACATGTG
Reviews

Customers who bought this product also purchased
A218
A218
A354
A354
A338
A338
A208
A208
A347
A347
A216
A216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2203
1 x A8
$36.00
Haplogroup Info
Other products
Currencies