Top » Catalog » R1b » A342

$18.00

A342
[A342]

A342
hg38 Position: ChrY:13684884..13684884
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A342_F ATAGTCCCAGCCCCCAAAC
Reverse Primer: A342_R ATACAGGCTCCTTTTTGGTTC
Reviews

Customers who bought this product also purchased
A214
A214
A351
A351
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A346
A346
A212
A212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies