Top » Catalog » R1b » A342

$18.00

A342
[A342]

A342
hg38 Position: ChrY:13684884..13684884
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A342_F ATAGTCCCAGCCCCCAAAC
Reverse Primer: A342_R ATACAGGCTCCTTTTTGGTTC
Reviews

Customers who bought this product also purchased
A210
A210
A348
A348
A218
A218
A354
A354
A338
A338
A208
A208
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A635
1 x A677
1 x A2127
1 x A104
1 x A952
1 x A966
1 x A800
1 x A183
1 x A2156
1 x A1229
$180.00
Haplogroup Info
Other products
Currencies