Top » Catalog » R1b » A344

$18.00

A344
[A344]

A344
hg38 Position: ChrY:14614830..14614830
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A344_F GCTAGCCAGTTTTCCTACCACTG
Reverse Primer: A344_R GCTCAATGAAATAAAAGAGGACAAAG
Reviews

Customers who bought this product also purchased
A218
A218
A354
A354
A338
A338
A347
A347
A208
A208
A352
A352
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies