Top » Catalog » R1b » A344

$18.00

A344
[A344]

A344
hg38 Position: ChrY:14614830..14614830
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A344_F GCTAGCCAGTTTTCCTACCACTG
Reverse Primer: A344_R GCTCAATGAAATAAAAGAGGACAAAG
Reviews

Customers who bought this product also purchased
A340
A340
A348
A348
A210
A210
A354
A354
A218
A218
A338
A338
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A2268
1 x A752
$54.00
Haplogroup Info
Other products
Currencies