Top » Catalog » R1b » A344

$18.00

A344
[A344]

A344
hg38 Position: ChrY:14614830..14614830
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A344_F GCTAGCCAGTTTTCCTACCACTG
Reverse Primer: A344_R GCTCAATGAAATAAAAGAGGACAAAG
Reviews

Customers who bought this product also purchased
A216
A216
A352
A352
A337
A337
A206
A206
A341
A341
A214
A214
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A474
1 x A2182
1 x A496
1 x A1282
$72.00
Haplogroup Info
Other products
Currencies