Top » Catalog » R1b » A341

$18.00

A341
[A341]

A341
hg38 Position: ChrY:13518500..13518500
Ancestral: A
Derived: G
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A341_F GCACACTGATGTGTCTTGACTG
Reverse Primer: A341_R AGCGCATCTGTCAGCAGG
Reviews

Customers who bought this product also purchased
A338
A338
A208
A208
A347
A347
A216
A216
A352
A352
A337
A337
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A908
1 x A212
$36.00
Haplogroup Info
Other products
Currencies