Top » Catalog » R1b » A341

$18.00

A341
[A341]

A341
hg38 Position: ChrY:13518500..13518500
Ancestral: A
Derived: G
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A341_F GCACACTGATGTGTCTTGACTG
Reverse Primer: A341_R AGCGCATCTGTCAGCAGG
Reviews

Customers who bought this product also purchased
A206
A206
A346
A346
A214
A214
A351
A351
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A559
1 x A466
1 x A600
1 x A817
1 x A770
1 x A2118
1 x A1279
1 x A442
1 x A903
1 x A2133
$180.00
Haplogroup Info
Other products
Currencies