Top » Catalog » R1b » A349

$18.00

A349
[A349]

A349
hg38 Position: ChrY:15426125..15426125
Ancestral: C
Derived: T
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A349_F AGAAGTGACCAAGTTGTTGTTAAGAG
Reverse Primer: A349_R CATCAGAAAAGGGTCATATTCCA
Reviews

Customers who bought this product also purchased
A292
A292
DYS481
DYS481
A342
A342
A211
A211
A348
A348
A217
A217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies