Top » Catalog » R1b » A350

$18.00

A350
[A350]

A350
hg38 Position: ChrY:15507401..15507401
Ancestral: C
Derived: A
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A350_F CAATGCTATCACCATCAATCTAGTG
Reverse Primer: A350_R CTTGCTTTTTTTTGTCAGGTTCA
Reviews

Customers who bought this product also purchased
A337
A337
A206
A206
A346
A346
A214
A214
A351
A351
A293
A293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1752
1 x A248
$36.00
Haplogroup Info
Other products
Currencies