Top » Catalog » R1b » A350

$18.00

A350
[A350]

A350
hg38 Position: ChrY:15507401..15507401
Ancestral: C
Derived: A
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A350_F CAATGCTATCACCATCAATCTAGTG
Reverse Primer: A350_R CTTGCTTTTTTTTGTCAGGTTCA
Reviews

Customers who bought this product also purchased
A211
A211
A348
A348
A355
A355
A217
A217
A340
A340
A210
A210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies