Top » Catalog » R1b » A350

$18.00

A350
[A350]

A350
hg38 Position: ChrY:15507401..15507401
Ancestral: C
Derived: A
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A350_F CAATGCTATCACCATCAATCTAGTG
Reverse Primer: A350_R CTTGCTTTTTTTTGTCAGGTTCA
Reviews

Customers who bought this product also purchased
A293
A293
R1b-A212 McRaney Family Panel
R1b-A212 McRaney Family Panel
A344
A344
A212
A212
A349
A349
A292
A292
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies