Top » Catalog » R1b » A352

$18.00

A352
[A352]

A352
hg38 Position: ChrY:16953348..16953348
Ancestral: G
Derived: T
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A352_F AAATCTTCAATAAAATACTAGCAAAGTGAC
Reverse Primer: A352_R CACACAATACTATGTTGAACAGGAGG
Reviews

Customers who bought this product also purchased
A212
A212
A349
A349
A292
A292
DYS481
DYS481
A342
A342
A211
A211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies