Top » Catalog » R1b » A355

$18.00

A355
[A355]

A355
hg38 Position: ChrY:20899450..20899450
Ancestral: C
Derived: A
Reference: Ron McRaney (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Approx. R1b-CTS4466
Forward Primer: A355_F CAACTCTTGTGCAGACTTAGACAG
Reverse Primer: A355_R AATGGAAGAATTGCAAGGAGAC
Reviews

Customers who bought this product also purchased
A217
A217
A354
A354
A340
A340
A210
A210
A347
A347
A218
A218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
$18.00
Haplogroup Info
Other products
Currencies