Top » Catalog » R1b » A1162

$18.00

A1162
[A1162]

A1162
hg38 Position: ChrY:13672227..13672227
Ancestral: T
Derived: G
Reference: David R Moore (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1a3a (not listed)
Comments: Below L1402
Forward Primer: A1162_F TTGAAACTTCACCAACATCACC
Reverse Primer: A1162_R CACACTGCTGTGTCTGCCAG
Reviews

Customers who bought this product also purchased
A1161
A1161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A225
1 x A902
1 x A1259
1 x A1537
1 x A419
1 x A2219
1 x A603
1 x A777
1 x A206
1 x A625
1 x A2253
1 x A1160
1 x A317
1 x A803
1 x A2208
1 x A166
1 x A988
1 x A797
1 x A1488
1 x A1778
$360.00
Haplogroup Info
Other products
Currencies