Top » Catalog » R1b » A195

$18.00

A195
[A195]

A195
hg38 Position: ChrY:7882703..7882703
Ancestral: T
Derived: C
Reference: Lance Brown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2
Comments: Parallel to S1121 and upstream of A88. Aka Z16253
Forward Primer: A195_F GGCCCAGGCAGAAAAGTC
Reverse Primer: A195_R GGATATTGGGCTGAGTGTGG
Reviews

Customers who bought this product also purchased
A7660
A7660
FT43021
FT43021
BY39364
BY39364
BY39361
BY39361
BY39363
BY39363
BY16028
BY16028
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies