Top » Catalog » R1b » A162

$18.00

A162
[A162]

A162
hg38 Position: ChrY:6924142..6924142
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A162v2_F ATTGTGGCCTCAACTTCCAG
Reverse Primer: A162v2_R CTGGCCCAACTTCACTTCTC
Reviews

Customers who bought this product also purchased
A194
A194
A177
A177
M3668
M3668
A165
A165
A184
A184
A171
A171
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies