Top » Catalog » R1b » A162

$18.00

A162
[A162]

A162
hg38 Position: ChrY:6924142..6924142
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A162v2_F ATTGTGGCCTCAACTTCCAG
Reverse Primer: A162v2_R CTGGCCCAACTTCACTTCTC
Reviews

Customers who bought this product also purchased
A194
A194
A175
A175
A193
A193
A163
A163
A181
A181
A169
A169
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies