Top » Catalog » R1b » A163

$18.00

A163
[A163]

A163
hg38 Position: ChrY:7424223..7424223
Ancestral: G
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A163_F TCTGTGAGGCTAAAACTTACGTGA
Reverse Primer: A163_R AGTTTAGAAACCATTAAAAATTCATGGA
Reviews

Customers who bought this product also purchased
A162
A162
A180
A180
A169
A169
A186
A186
A174
A174
A191
A191
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies