Top » Catalog » R1b » A164

$18.00

A164
[A164]

A164
hg38 Position: ChrY:7793360..7793360
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A164_F GAGTCAAAATAAACTAATTGCGGACTAC
Reverse Primer: A164_R GCTGCATACGTCCTTCCTTATG
Reviews

Customers who bought this product also purchased
A177
A177
CTS2085
CTS2085
A165
A165
A183
A183
A171
A171
A188
A188
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies