Top » Catalog » R1b » A165

$18.00

A165
[A165]

A165
hg38 Position: ChrY:7807802..7807802
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A165_F AGAGGGGCAGGGAGAGTAAC
Reverse Primer: A165_R TTTTTCTGTCTGGGCCTTTG
Reviews

Customers who bought this product also purchased
A178
A178
M3668
M3668
A166
A166
A184
A184
A172
A172
A189
A189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies