Top » Catalog » R1b » A166

$18.00

A166
[A166]

A166
hg38 Position: ChrY:7818404..7818404
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A166_F TTCTTGGGTGAGCAGGAAAC
Reverse Primer: A166_R TAGGCCTCAGAGTGGCTTG
Reviews

Customers who bought this product also purchased
A172
A172
A189
A189
CTS2085
CTS2085
A177
A177
A164
A164
A183
A183
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies