Top » Catalog » R1b » A169

$18.00

A169
[A169]

A169
hg38 Position: ChrY:8381076..8381076
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A169_F CTGGATTCTGAAGTCAAGATACCTTAC
Reverse Primer: A169_R TATCACATATCTCCAACCCTATCAAC
Reviews

Customers who bought this product also purchased
A164
A164
A183
A183
A171
A171
A188
A188
A176
A176
A193
A193
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies