Top » Catalog » R1b » A169

$18.00

A169
[A169]

A169
hg38 Position: ChrY:8381076..8381076
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A169_F CTGGATTCTGAAGTCAAGATACCTTAC
Reverse Primer: A169_R TATCACATATCTCCAACCCTATCAAC
Reviews

Customers who bought this product also purchased
A175
A175
A192
A192
A180
A180
A162
A162
A186
A186
A167
A167
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies