Top » Catalog » R1b » A170

$18.00

A170
[A170]

A170
hg38 Position: ChrY:8566305..8566305
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A170_F CTGGCTTTTGCCTGGTAGTC
Reverse Primer: A170_R TAGTGCTTTTGAGGGGCAAC
Reviews

Customers who bought this product also purchased
A167
A167
A186
A186
A174
A174
A191
A191
A179
A179
A166
A166
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A687
1 x A1343
1 x A1504
1 x A807
1 x A593
1 x A564
1 x A2233
1 x A340
1 x A1265
1 x A1191
$180.00
Haplogroup Info
Other products
Currencies