Top » Catalog » R1b » A170

$18.00

A170
[A170]

A170
hg38 Position: ChrY:8566305..8566305
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A170_F CTGGCTTTTGCCTGGTAGTC
Reverse Primer: A170_R TAGTGCTTTTGAGGGGCAAC
Reviews

Customers who bought this product also purchased
M3668
M3668
A178
A178
A184
A184
A165
A165
A189
A189
A172
A172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies