Top » Catalog » R1b » A172

$19.00

A172
[A172]

A172
hg38 Position: ChrY:9561021..9561021
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496 and a R1a-YP441 person.
Forward Primer: A172_F ACATTTCACCAACTTCTACCTTCTATAAC
Reverse Primer: A172_R CACATGTTGCAGGTAGGACCT
Reviews

Customers who bought this product also purchased
A173
A173
A190
A190
A178
A178
M3668
M3668
A165
A165
A184
A184
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies