Top » Catalog » R1b » A172

$18.00

A172
[A172]

A172
hg38 Position: ChrY:9561021..9561021
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496 and a R1a-YP441 person.
Forward Primer: A172_F ACATTTCACCAACTTCTACCTTCTATAAC
Reverse Primer: A172_R CACATGTTGCAGGTAGGACCT
Reviews

Customers who bought this product also purchased
A189
A189
A171
A171
A177
A177
CTS2085
CTS2085
A183
A183
A164
A164
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies