Top » Catalog » R1b » A174

$18.00

A174
[A174]

A174
hg38 Position: ChrY:10146777..10146777
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A174v2_F GCTTCCTTGGGTACCTCTCTTTC
Reverse Primer: A174v2_R GACACCTAAACATTTGTTCCACC
Reviews

Customers who bought this product also purchased
A192
A192
A175
A175
A162
A162
A180
A180
A167
A167
A186
A186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies