Top » Catalog » R1b » A175

$18.00

A175
[A175]

A175
hg38 Position: ChrY:12090933..12090933
Ancestral: T
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A175_F TTGGGCCTATGATCAACCTC
Reverse Primer: A175_R TTCTAGAGCCAATGCAAAAGC
Reviews

Customers who bought this product also purchased
A171
A171
A189
A189
A177
A177
CTS2085
CTS2085
A164
A164
A183
A183
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies