Top » Catalog » R1b » A175

$18.00

A175
[A175]

A175
hg38 Position: ChrY:12090933..12090933
Ancestral: T
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A175_F TTGGGCCTATGATCAACCTC
Reverse Primer: A175_R TTCTAGAGCCAATGCAAAAGC
Reviews

Customers who bought this product also purchased
A169
A169
A187
A187
A174
A174
A192
A192
A162
A162
A180
A180
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies