Top » Catalog » R1b » A175

$18.00

A175
[A175]

A175
hg38 Position: ChrY:12090933..12090933
Ancestral: T
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A175_F TTGGGCCTATGATCAACCTC
Reverse Primer: A175_R TTCTAGAGCCAATGCAAAAGC
Reviews

Customers who bought this product also purchased
A167
A167
A186
A186
A173
A173
A191
A191
A179
A179
A166
A166
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies