Top » Catalog » R1b » A176

$18.00

A176
[A176]

A176
hg38 Position: ChrY:12842111..12842111
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A176_F AGCATTGCTCACGTTGAAAG
Reverse Primer: A176_R GCACTAGGGCACTCCAGAAG
Reviews

Customers who bought this product also purchased
A181
A181
A163
A163
A187
A187
A169
A169
A192
A192
A174
A174
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A907
1 x A62
1 x A71
1 x A214
1 x A119
1 x A700
1 x A594
1 x A1066
1 x A1715
1 x A421
1 x A890
1 x A173
$216.00
Haplogroup Info
Other products
Currencies