Top » Catalog » R1b » A176

$18.00

A176
[A176]

A176
hg38 Position: ChrY:12842111..12842111
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A176_F AGCATTGCTCACGTTGAAAG
Reverse Primer: A176_R GCACTAGGGCACTCCAGAAG
Reviews

Customers who bought this product also purchased
A172
A172
A190
A190
A178
A178
M3668
M3668
A165
A165
A184
A184
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies