Top » Catalog » R1b » A177

$18.00

A177
[A177]

A177
hg38 Position: ChrY:12998464..12998464
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A177_F GCATCATGAGTAATTTTCAGAAGAAAC
Reverse Primer: A177_R TTTTACAATTTATTGTTTTCCCGC
Reviews

Customers who bought this product also purchased
A175
A175
A193
A193
A163
A163
A181
A181
A169
A169
A187
A187
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies