Top » Catalog » R1b » A179

$18.00

A179
[A179]

A179
hg38 Position: ChrY:14301390..14301390
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A179_F GCAAGGGTCTAGGCTGGAG
Reverse Primer: A179_R CAAAGGCCAATGTGTCTAAATG
Reviews

Customers who bought this product also purchased
A175
A175
A193
A193
A163
A163
A181
A181
A169
A169
A187
A187
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14645
1 x A20817
1 x A19334
1 x A19281
1 x A19277
1 x A13641
1 x A15553
1 x A17831
1 x A12925
1 x A14644
1 x A13647
1 x A18932
1 x A19279
1 x A20820
1 x A19274
1 x A18468
1 x A15547
1 x A12921
1 x A15548
1 x A13649
1 x A18931
1 x A19931
1 x A17372
1 x A13639
1 x A12919
1 x A19275
1 x A10970
1 x A13645
1 x A14648
1 x A18555
1 x A19336
1 x A20954
1 x A13638
1 x A19929
1 x A18940
1 x A14641
1 x A15551
1 x A17833
1 x A19335
1 x A13637
1 x A18939
1 x A14639
1 x A12918
1 x A19218
1 x A16982
1 x A19280
1 x A19263
1 x A21955
1 x A15550
1 x A18554
1 x A13633
1 x A13635
1 x A13650
$954.00
Haplogroup Info
Other products
Currencies