Top » Catalog » R1b » A179

$18.00

A179
[A179]

A179
hg38 Position: ChrY:14301390..14301390
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A179_F GCAAGGGTCTAGGCTGGAG
Reverse Primer: A179_R CAAAGGCCAATGTGTCTAAATG
Reviews

Customers who bought this product also purchased
A174
A174
A192
A192
A162
A162
A180
A180
A167
A167
A186
A186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies