Top » Catalog » R1b » A179

$18.00

A179
[A179]

A179
hg38 Position: ChrY:14301390..14301390
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A179_F GCAAGGGTCTAGGCTGGAG
Reverse Primer: A179_R CAAAGGCCAATGTGTCTAAATG
Reviews

Customers who bought this product also purchased
A166
A166
A185
A185
A172
A172
A190
A190
A177
A177
M3668
M3668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies