Top » Catalog » R1b » A180

$18.00

A180
[A180]

A180
hg38 Position: ChrY:14648493..14648493
Ancestral: A
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A180v2_F GCATGGTGGTACATGCCC
Reverse Primer: A180v2_R TCAAACATGCAGAGCTCAAATC
Reviews

Customers who bought this product also purchased
A173
A173
A191
A191
A178
A178
A166
A166
A185
A185
A172
A172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies