Top » Catalog » R1b » A181

$18.00

A181
[A181]

A181
hg38 Position: ChrY:14766288..14766288
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A181_F TTAGTATGTCAGTGAAGGGAAATCTG
Reverse Primer: A181_R TGTGAATGTTGTACTTCACTGTGG
Reviews

Customers who bought this product also purchased
A165
A165
A184
A184
A171
A171
A189
A189
A176
A176
CTS2085
CTS2085
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies